Skip to main content

Table 1 Primers used for qRT-PCR assay

From: Ginsenoside Rg3 alleviates septic liver injury by regulating the lncRNA TUG1/miR-200c-3p/SIRT1 axis

Gene Sequence (5′ → 3′)
TUG1 (mouse) Forward: GAGACACGACTCACCAAGCA
Reverse: GAAGGTCATTGGCAGGTCCA
TUG1 (human) Forward: ACGACTGAGCAAGCACTACC
Reverse: CTCAGCAATCAGGAGGCACA
miR-200a-3p Forward: CGCCGTAACACTGTCTGGTAA
Reverse: TCCTCCTCTCCTTCCTTCTC
SIRT1 Forward: CAGTGGCTGGAACAGTGAGA
Reverse: TCTGGCATGTCCCACTATCA
GAPDH (mouse) Forward: AGCCCAAGATGCCCTTCAGT
Reverse: CCGTGTTCCTACCCCCAATG
GAPDH (human) Forward: CCAGGTGGTCTCCTCTGA
Reverse: GCTGTAGCCAAATCGTTGT
U6 Forward: CTCGCTTCGGCAGCACA
Reverse: AACGCTTCACGAATTTGCGT