Skip to main content

Table 1 Mouse primers used for qRT-PCR

From: Deficiency of fibroblast growth factor 21 aggravates obesity-induced atrophic responses in skeletal muscle

Gene Forward primer (5′ → 3′) Reverse primer (5′ → 3′)
TNFα AAGCCTGTAGCCCACGTCGTA GGCACCACTAGTTGGTTGTCTTTG
MCP-1 GCATCCACGTGTTGGCTCA CTCCAGCCTACTCATTGGGATCA
Atrogin-1 ACATTCTGCCAGCTGCTGTTTC TGAGTTGGATGCTGGGCCTAC
MuRF1 TGTCTCACGTGTGAGGTGCCTA CACCAGCATGGAGATGCAGTTAC
ATF4 CGGCTGGTCGTCAACCTATAAAGTA GGTAACTGTGGCGTTAGAGATCGT
CHOP AGTGCATCTTCATACACCACCACA CAGATCCTCATACCAGGCTTCCA
β-actin CATCCGTAAAGACCTCTATGCCAAC ATGGAGCCACCGATCCACA