Skip to main content

Table 2 Primers designs used for Real Time Polymerase Chain Reaction (RT-PCR)

From: Caspase recruitment domain (CARD) family (CARD9, CARD10, CARD11, CARD14 and CARD15) are increased during active inflammation in patients with inflammatory bowel disease

GENE GENEBANK OLIGO LEFT OLIGO RIGHT UNIVERSAL PROBE LIBRARY AMPLICON SIZE
CARD9 NM_052814.3, NM_052813.4 ggagacgctcgtcctgag aggtcctgggggagtgag 79 gagacgctcgtcctgagctccgacctggaagatggctcacccaggaggtcccaggagctctcactcccccaggacct
CARD10 NM_014550.3 actaccccgaacacttcacg gtcatcaagaattgggtcagg 72 actaccccgaacacttcacgctgctcacgggccaggaacccgcccagcgctgctccatgatcctcgatgaggaggggcctgagggcctgacccaattcttgatgac
CARD11 NM_032415.4 cagaggagctgcgagacaa ggtgcttgtacatttcacagtcc 1 cagaggagctgcgagacaagtacctggaggagaaggaggacctggagctcaagtgctcgaccctgggaaaggactgtgaaatgtacaagcacc
CARD14 NM_024110.3 gagctcctagacacggcaga cgagacatcaagccttccag 71 gagctcctagacacggcagaccttccgcagctggaaagcagcctgcagccagtctcccctggaaggcttgatgtctc
CARD15 NM_022162.1 gtgtcctcctcggacattct ggaccctgagaccagcag 36 gtgtcctcctcggacattctccgggttgtgaaatgtgctcgcaggaggcttttcaggcacagaggagccagctggtcgagctgctggtctcagggtcc
GAPDH NM_002046.3 agccacatcgctcagaca gcccaatacgaccaaatcc 60 agccacatcgctcagacaccatggggaaggtgaaggtcggagtcaacggatttggtcgtattgggc
  1. CARD9 assay was designed to detect both transcript isoforms (Universal Probe Library)