Skip to main content

Table 1 Primers and products sizes

From: Augmentation of Pulmonary Epithelial Cell IL-8 Expression and Permeability by Pre-B-cell Colony Enhancing Factor

Products 5' Primers 3' Primers Size (bp) Accession No.
IL-8 ATGACTTCCAAGCTGGCCGT CCTCTTCAAAAACTTCTCCACACC 297 NM_000584
PBEF AAGCTTTTTAGGGCCCTTTG AGGCCATGTTTTATTTGCTGACAAA 319 NM_005746
β-actin CAAACATGATCTGGGTCATCTTCTC GCTCGTCGTCGACAACGGCTC 487 NM_001101