Skip to main content

Table 1 Nucleotide sequences of real-time PCR primers and TaqMan probes

From: Green tea increases anti-inflammatory tristetraprolin and decreases pro-inflammatory tumor necrosis factor mRNA levels in rats

mRNA Accession No Amplicon size Forward primer (5' to 3') TaqMan probe (TET – BHQ1) Reverse primer (5' to 3')
Ttp/Tis11/Zfp36 NM_011756 70 bp GGTACCCCAGGCTGGCTTT AACTCAATATAATCCTGCCTTAGCCTT ACCTGTAACCCCAGAACTTGGA
Zfp36l1/Tis11b NM_007564 60 bp TGCGAACGCCCACGAT ACCACCACCCTCGTGTCCGCC CTTCGCTCAAGTCAAAAATGG
Zfp36l2/Tis11d NM_001001806 77 bp GAGGGCACCTCCCAACCT TTGCAATTTCGACCATTACAGGACCCA TGACAGAAGTGTGGTCGACATTT
Zfp36l3 NM_001009549 70 bp CGAACTGCGTACCCTGTCAAG CACCCCAAGTACAAGACGGAGCCTTG GCCAACGCTGTGGAAGGT
Tnf NM_013693 66 bp GCTGTCGCTACATCACTGAACCT TGCTCCCCACGGGAGCCG TGACCCGTAGGGCAATTACA
Ptgs2/Cox2 NM_011198 106 bp CCACCTCTGCGATGCTCTTC AGCTGTGCTGCTCTGCGCT CATTCCCCACGGTTTTGACATG
Csf2/Gm-csf NM_009969 71 bp CACCCGCTCGCCCAACCC TCACCCGGCCTTGGAAGCATGTAGA GGAGGCTCAGAGCTTCTTTGA
Elavl1/Hua/Hur NM_010485 69 bp CCTCCGAGCCCATCACAGT AAGTTTGCAGCCAATCCCAACCAGAA GCGAGAGGAGAGCCATGTTT
Vegfa NM_001025250 68 bp CAAAAACGAAAGCGCAAGAAA CCCGGTTTAAATCCTGGAGCG CGCTCTGAACAAGGCTCACA
Vegfb NM_011697 83 bp GATCCAGTACCCGAGCAGTCA TGTCCCTGGAAGAACACAGCCAATGTG TCTCCTTTTTTTTTGGTCTGCAT
Rpl32 NM_172086 66 bp AACCGAAAAGCCATTGTAGAAA AGCAGCACAGCTGGCCATCAGAGTC CCTGGCGTTGGGATTGG