Skip to main content

Table 3 TLR specific primers and RT-PCR conditions

From: Role of toll-like receptors in human iris pigment epithelial cells and their response to pathogen-associated molecular patterns

Genes Sequence (5′ to 3′ direction) Annealing temperature (°C) Cycles Amplicon size (bp)
TLR1 F: AAAAGAAGACCCTGAGGGCC 62 35 340
  R: TCTGAAGTCCAGCTGACCCT  
TLR2 F: GTACCTGTGGGGCTCATTGT 62 35 191
  R: CTGCCCTTGCAGATACCATT  
TLR3 F: AAATTGGGCAAGAACTCACAGG 60 35 320
  R: GTGTTTCCAGAGCCGTGCTAA  
TLR4 F: TACAAAATCCCCGACAACCTC 60 35 264
  R: AGCCACCAGCTTCTGTAAACT  
TLR5 F: TGCATTAAGGGGACTAAGCCTC 60 35 351
  R: AAAAGGGAGAACTTTAGGGACT  
TLR6 F: TCTTGGGATTGAGTGCTATGA 60 35 337
  R: GTCGTTTCTATGTGGTTGAGG    
TLR7 F: TCCAGTGTCTAAAGAACCTGG 60 38 352
  R: TGGTAAATATACCACACATCCC    
TLR8 F: TAATAGGCTGAAGCACATCCC 60 35 621
  R: TCCCAGTAAAACAAATGGTGAG    
TLR9 F: GTGCCCCACTTCTCCATG 60 35 260
  R: GGCACAGTCATGATGTTGTTG    
TLR10 F: TGACCACAATTCATTTGACTACTC 60 35 478
  R:TTGAATACTTTTGGGCAAGCACC    
GAPDH F:ACCACAGTCCATGCCATCAC 60 28 452
  R:TCCACCACCCTGTTGCTGTA    
Genes Sequence Accession number Cycles Amplicon size (bp)
TLR2* Sequences refer to Qiagen NNM_003264 45 92
TLR3*   NNM_003265 45 90
TLR4*   NNM_138554 45 111
TLR6*   NNM_006068 45 78
GAPDH*   NNM_001256799 45 95
  1. F = forward primer; R = reverse primer; bp = base pair. *Primer mix used for real-time PCR.