Skip to main content

Table 1 Primers for quantitative real-time PCR

From: Luteolin transforms the polarity of bone marrow-derived macrophages to regulate the cytokine storm

Genes Forward (5′-3′) Reverse (5′-3′)
CD86 TCAATGGGACTGCATATCTGCC GCCAAAATACTACCAGCTCACT
iNOS CAGAGGACCCAGAGACAAGC TGCTGAAACATTTCCTGTGC
IL-6 TAGTCCTTCCTACCCCAATTTC TTGGTCCTTAGCCACTCCTTC
TNF-α CCTCCCTCTCATCAGTTCTA ACTTGGTGGTTTGCTACGAC
Arg1 CAGAAGAATGGAAGAGTCAG CAGATATGCAGGGAGTC
CD206 CAGGTGTGGGCTCAGGTAGT TGTGGTGAGCTGAAAGGTGA
FIZZ1 GCTACTGGGTGTGCTTGTG CTGGGTTCTCCACCTCTTC
IL-13 GGGGAGTCTGGTCTTGTGTGA CTCTTGCTTGCCTTGGTGGTC
IL-10 CTTACTGACTGGCATGAGGATCA GCAGCTCTAGGAGCATGTGG
GAPDH TGAAGCAGGCATCTGAGGG CGAAGGTGGAAGAGTGGGAG