Skip to main content

Table 1 The list of primers used for real-time PCR analysis

From: Asthmatic condition induced the activity of exosome secretory pathway in rat pulmonary tissues

Gene Primer sequence (5'-3')
Forward Reverse
IL-4 CTGTCACCCTGTTCTGCTTTCT CTGGTACAAACATCTCGGTGCA
IL-10 TGAGAATAAAAGCAAGGCAGTGG GTAGGCTTCTATGCAGTTGATGA
GAPDH TTG CCA TCA ACG ACC CCT TCA AGC ACC AGC ATC ACC CCA TTT