Skip to main content

Table 1 Sequence of primers and annealing temperature

From: Chronic intermittent hypobaric hypoxia improves markers of iron metabolism in a model of dietary-induced obesity

Gene Primer sequence Annealing temperature
Hepcidin F 5′- AGATGGCACTAAGCACTCGG − 3′
R 5′- ATCAGCAGCGCACTGTCATC − 3’
56 °C
β-actin F 5’- GAAATCGTGCGTGACATTAAAGAG − 3′
R 5′- GCGGCAGTGGCCATCTC − 3’
56 °C