Skip to main content

Table 1 The primer sequences. The GADPH was used as an internal control

From: Structural and functional abnormalities of penile cavernous endothelial cells result in erectile dysfunction at experimental autoimmune prostatitis rat

Item5′---------3’
TNF-α-FAGGGAATTGTGGCTCTGGGT
TNF-α-RAGGCCACTACTTCAGCGTCT
IL-1β-FAGAATGGGCAGTCTCCAGGG
IL-1β-RGACCAGAATGTGCCACGGTT
IL-6-FATTCTGTCTCGAGCCCACCA
IL-6-RAGGCAACTGGCTGGAAGTCT
AR-FCCAGGGACCATGTTTTGCC
AR-RCGAAGACGACAAGATGGACAA
Enos-FGTCTGGAGGGCTAAGCAGTC
Enos-RGCAAGGAAGGTTGACAGTATGC
Akt-FGTGGACTTACCTTATCCCCTCA
Akt-RTTGGCTTTGGTCGTTCTGTTT
GAPDH-FGCAAGTTCAACGGCACAG
GAPDH-RGCCAGTAGACTCCACGACAT