Skip to main content

Table 1 Primer sequences of biomarkers detected in the present study

From: Cannabinoid 2 receptor attenuates inflammation during skin wound healing by inhibiting M1 macrophages rather than activating M2 macrophages

Biomarker Primer Product size (bp) GenBank ID
IL-4 Forward AACGTCCTCACAGCAACGAA 164 NM_021283
Reverse AGGCATCGAAAAGCCCGAAA
IL-6 Forward GTCCTTCCTACCCCAATTTCCA 151 NM_031168
Reverse CGCACTAGGTTTGCCGAGTA
IL-10 Forward TGGGTTGCCAAGCCTTATCG 118 NM_010548
Reverse TTCAGCTTCTCACCCAGGGA
IL-12A Forward CTGCCGGCTATCCAGACAAT 168 NM_008351
Reverse TGGCCAAACTGAGGTGGTTT
CD86 Forward CTTACGGAAGCACCCACGAT 147 NM_019388
Reverse TGTAAATGGGCACGGCAGAT
CD206 Forward TTCCATCGAGACTGCTGCTG 168 NM_008625
Reverse CCAGAGGGATCGCCTGTTTT
iNOS Forward CTATGGCCGCTTTGATGTGC 111 NM_010927
Reverse TTGGGATGCTCCATGGTCAC
Arg1 Forward ACATTGGCTTGCGAGACGTA 109 NM_007482
Reverse ATCACCTTGCCAATCCCCAG
β-actin Forward ACCTTCTACAATGAGCTGCG 147 NM_007393
Reverse CTGGATGGCTACGTACATGG