Skip to main content

Table 2 Primer sequences for real-time PCR

From: Hyperoside attenuates dextran sulfate sodium-induced colitis in mice possibly via activation of the Nrf2 signalling pathway

Name Primer Sequence
β- actin Forward 5’- CACGATGGAGGGGCCGGACTCATC-3’
  Reverse 5’- TAAAGACCTCTATGCCAACACAGT-3’
Nrf2 Forward 5’- GAGCTAGATAGTGCCCCTGG -3’
  Reverse 5’- CAGGACTCACGGGAACTTCT -3’
SOD Forward 5’- AACCATCCACTTCGAGCAGA -3’
  Reverse 5’- GGTCTCCAACATGCCTCTCT -3’
HO-1 Reverse 5’- CCCTAATGAGCTGCCCTACA -3’
  Forward 5’- TTCATCCCCACTCTCTTCGG -3’
TNF-a Forward 5’- ACCCTCACACTCACAAACCA -3’
  Reverse 5’- GGCAGAGAGGAGGTTGACTT -3’
IL-4 Forward 5’- TCTCGAATGTACCAGGAGCC-3’
  Reverse 5’- ACCTTGGAAGCCCTACAGAC-3’
IL-6 Forward 5’-GTTGCCTTCTTGGGACTGAT-3’
  Reverse 5’-ATTAAGCCTCCGACTTGTGA-3’
IL-10 Forward 5’- ATAACTGCACCCACTTCCCA-3’
  Reverse 5’- GGGCATCACTTCTACCAGGT-3’
Bcl-2 Forward 5’- TCGCAGAGATGTCCAGTCAG-3’
  Reverse 5’- ATCTCCCTGTTGACGCTCTC-3’
Bax Forward 5’-TCATGAAGACAGGGGCCTTT -3’
  Reverse 5’-GTCCACGTCAGCAATCATCC -3’
Caspase-3 Forward 5’- CTACAGCACCTGGTTACTATTC-3’
  Reverse 5’- TACAGTTCTTTCGTGAGCAT-3’