Table 1 Sequences of Primers and conditions used in quantitative reverse transcriptase-polymerase chain reaction (RT-qPCR)
Primer | Abbreviation | Sequence (3′ – 5′) |
|---|---|---|
Glyceraldehyde-3-phophate Dehydrogenase | GAPDH | |
Sense Antisense | ctctgctcctcctgttcgac acgaccaaatccgttgactc | |
Aggrecan core protein 1 | ACAN | |
Sense Antisense | cctccccttcacgtgtaaaa gctccgcttctgtagtctgc | |
Collagen, type II, alpha 1 | COL2A1 | |
Sense Antisense | gtgtcagggccaggatgt tcccagtgtcacagacacagat | |
Collagen, type I, alpha 1 | COL1A1 | |
Sense Antisense | gggattccctggacctaaag ggaacacctcgctctccag | |
Matrix metalloproteinase 3 | MMP3 | |
Sense Antisense | caaaacatatttctttgtagaggacaa ttcagetattcgcttgggaaa | |
Matrix metalloproteinase 9 | MMP9 | |
Sense Antisense | cgaactttgacagcgacaag gccacgaggaacaaactgtat | |
Matrix metalloproteinase 13 | MMP13 | |
Sense Antisense | tttcctcctgggccaaat gcaacaagaaacaagttgtagcc | |
Inducible nitric oxide synthase 2 | iNOS | |
Sense Antisense | gaccagtacgtttggcaatg tttcagcatgaagagcgattt |