Skip to main content

Table 2 Primers used for RT-QPCR analysis

From: Antioxidant polyphenol-rich extracts from the medicinal plants Antirhea borbonica, Doratoxylon apetalum and Gouania mauritiana protect 3T3-L1 preadipocytes against H2O2, TNFα and LPS inflammatory mediators by regulating the expression of superoxide dismutase and NF-κB genes

Mouse gene Forward primer Reverse primer Detection
NF-κB CATTTGAACACTGCTTTGACTCACT GTGATGGGCCTTCACACACA Sybrgreen
Cu/Zn SOD GCAGGGAACCATCCACTT TACAACCTCTGGAACCGT Sybrgreen
Catalase CCTCCTCGTTCAGGATGTGGTT CGAGGGTCACGAACTGTGTCAG Sybrgreen
GAPDH TTCACCACCATGGAGAAGGC GGCATGGACTGTGGTCATGA Sybrgreen