Skip to main content

Table 1 Details of primers used in this study

From: Expression of BMP4 in myocardium and vascular tissue of obese mice

Gene Forward primer (5′–3′) PCR product size (base pairs)
Reverse primer (5′–3′)
BMP4 F:CGCCAGCCGAGCCAACAC 169
R:GGTCCACCTGCTCCCGAAAGA
IL-1β F:TGTGATGTTCCCATTAGAC 131
R:AATACCACTTGTTGGCTTA
IL-9 F:CCAGCTTCCAAGTGCCACTGC 125
R:TGCATGGTGGTATTGGTCATCTG
Smad1 F:AAACAGGGCGATGAAGAAGA 216
R:CCACACACGGCAGTAAATGA
β-actin F:ACACCCGCCACCAGTTCGC 198
R:TCTGGGCCTCGTCACCCACAT