Skip to main content

Table 1 Forward and reverse primer sequences, RT-PCR product length and accession number (Acc.No.) in the EMBL database

From: Differential expression of nitric oxide synthases in porcine aortic endothelial cells during LPS-induced apoptosis

Primer Sequence (5-3) Product Length (bp) Acc. No.
eNOS For.: GCTCTCACCTTCTTCCTG 144 AY266137
Rev.: CCACTTCCACTCCTCATAG
iNOS For.: CAACAATGGCAACATCAGG 119 U59390
Rev.: CATCAGGCATCTGGTAGC
HPRT For.: GGACAGGACTGAACGGCTTG 115 AF143818
Rev.: GTAATCCAGCAGGTCAGCAAAG