Skip to main content

Table 2 Primer and probe sequences used to quantify gene expression by real-time polymerase chain reaction (PCR)

From: NOD2 is highly expressed in Behçet disease with pulmonary manifestations

Genes Δ Probe sequence 5'-(FAM - TAMRA)-3' Product size
  • L primer-5'-3'  
  ■ R primer-5'-3'  
IL-4 Δ AAACCTTCTGCAGGGCTGCGAC 71 bp
  • GCTGCCTCCAAGAACACAAC  
  ■ CTGTAGAACTGCCGGAGCAC  
NOD1 Δ CCTGGCTCCGACATCGGTGA 133 bp
  • AAGCGAAGAGCTGACCAAAT  
  ■ TCCCAGTTTAAGATGCGTGA  
NOD2 Δ CCGAGGCATCTGCAAGCTCA 82 bp
  • CTGCAAGGCTCTGTATTTGC  
  ■ CTCGCAGTGAAGAGCACATT  
HuPO Δ TGCCAGTGTCTGTCTGCAGATTGG 105 bp
  • GCTTCCTGGAGGGTGTCC  
  ■ GGACTCGTTTGTACCCGTTG  
TLR2 Δ GGAGTTCTCCCAGTGTTTGG 105 bp
  • GCATTGTCCAGTGCTTCAAC  
TLR4 Δ AGTGAGGATGATGCCAGGAT 147 bp
  • TTCATGCCAGCTCTTCTGTG  
  1. HuPO: human acidic ribosomal protein; IL: interleukin.