Skip to main content

Table 2 Primer sequences used for quantitative Real-time RT-PCR

From: Investigation of Telomerase/Telomeres system in Bone Marrow Mesenchymal Stem Cells derived from IPF and RA-UIP

Gene Primer pair Sequence (5′-3′) Annealing Temperature
hTERT FOR: TGACACCTCACCTCACCCAC 51°C
  REV: CACTGTCTTCCGCAAGTTCAC  
hTERC FOR: GCCTGCCGCCTTCCACCGTTCATT 59°C
  REV: GACTCGCTCCGTTCCTCTTCCTG  
TELOMERE FOR: CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT 56°C
  REV: GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT  
ACTIN FOR: CGGCATCGTCACCAACTG 58°C
  REV: GGCACACGCAGCTCATTG