Skip to main content

Table 2 Primer sequences used for quantitative Real-time RT-PCR

From: Investigation of Telomerase/Telomeres system in Bone Marrow Mesenchymal Stem Cells derived from IPF and RA-UIP

Gene

Primer pair Sequence (5′-3′)

Annealing Temperature

hTERT

FOR: TGACACCTCACCTCACCCAC

51°C

 

REV: CACTGTCTTCCGCAAGTTCAC

 

hTERC

FOR: GCCTGCCGCCTTCCACCGTTCATT

59°C

 

REV: GACTCGCTCCGTTCCTCTTCCTG

 

TELOMERE

FOR: CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT

56°C

 

REV: GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT

 

ACTIN

FOR: CGGCATCGTCACCAACTG

58°C

 

REV: GGCACACGCAGCTCATTG