Skip to main content

Table 1 Transcripts analyzed by real-time PCR, gene symbols and primer sequences

From: Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts

Target transcript Gene Polarity Sequence (5'→3')
IDO1 INDO Sense GCATTTTTCAGTGTTCTTCGCATA
   Anti-sense CATACACCAGACCGTCTGATAGCT
TDO TDO2 Sense GAACATCTTTTTATCATAACTCATCAAGCT
   Anti-sense ACAACCTTAAGCATGTTCCTTTCAT
KMO KMO Sense TGTAATCCTCCAAGCTTCAATCTG
   Anti-sense CTAGTAGATGCCCACTGAATATTTGTG
HAAO HAAO Sense GGACGTTCTGTTTGAGAAGTGGTT
   Anti-sense AGCTGAAGAACTCCTGGATGATG
KAT1 CCBL1 Sense CCTGCTAAGGCTCAGGTATAACCT
   Anti-sense GGACTCAAGCCTAAAGGCAACTC
KAT2 AADAT Sense CACATCTGGCAGCCAACAAG
   Anti-sense CACTGGCAACATTAATAATGTTGCA
KAT3 CCBL2 Sense ACTATCAGCCATCCCCGTTTC
   Anti-sense AATGAAGCAAAAACGCACAAACT
KAT4 GOT2 Sense TGTGGTGTGCAGCCTCTCAT
   Anti-sense AAGCCTGAACCCAGCTAGCA
KYNU KYNU Sense ACAGGATCTGCCTCCAGTTGA
   Anti-sense TGGCCCACTTATCTAGTTCTTCTTC
QPRT QPRT Sense ACACCGGCCATGGGTTAAC
   Anti-sense GCCCCATTGGCCACTGA
GAPDH GAPDH Sense CACATGGCCTCCAAGGAGTAA
   Anti-sense TGAGGGTCTCTCTCTTCCTCTTGT