Skip to main content

Table 2 PCR Primers for Salmonella effector proteins

From: The inflammatory cytokine tumor necrosis factor modulates the expression of Salmonella typhimurium effector proteins

Gene Forward primers Reverse primers Access No.
AvrA 5'GAATGGAAGGCGTTGAATCTGC3' 5'TTGTGCGCCTTGAGTATGTTTGTAA3' NP_461786.1
gogB 5' TTC ATA TTT CCC AGA TAG CTT AG 3' 5' TCT TGC CTT ACA TAA ACC ATA A 3' NP_461519.1
luxR 5' GAA CTA TAT CGC TCC TCA TGA CA 3' 5' TCC CAA AGA ATA GGT GAG TGA TT 3' YP_002265254.1
luxS 5' CAC ATC CGC CAT CGC CGC TTT C 3' 5' GTT TGC TGG CTT TAT GCG CGA CC 3' YP_002227567.1
pipB1 5' AGA ATT GCA GCG GTT AAG TTT AC 3' 5' CTG GAG GAT GTC AAC GGG TGT 3' NP_460061.1
pipB2 5' ACC TTC ACA ATC CGC CAT A 3' 5' TAC GAG TCA GTA AAG GCG ACC AT 3' NP_461706.1
sifA 5' TAG GTA TGT GGG TAT GCG GTG GT 3' 5' CAA ATG ACG GCC ATG ATT AAG A 3' NP_460194.1
sifB 5' CCC TGA GCG GTT ACA ACT C 3' 5' CGT CGT CAA TAG CTG TTA CAC CT 3' NP_460561.1
sipA 5' TGT TCG GCT ATT ATC AAT CGT CT 3' 5' CGC AGC AAT CTT ACG CAC CT 3' NP_461803.1
sipB 5' CTG ACT GGG CTG CGG TAT TCG TG 3' 5' CTG CGG TGG GAC TTG CGG TAA 3' NP_461806.1
sipC 5' GCC TTC AGC ACC GAG TTT G 3' 5' ATG TCA CGA CTA AAG CGA ATG AG 3' NP_461805.1
slrP 5' GAT ACG CAG AAT ACC CGA CAC CC 3' 5' CCG CCA TAA TCA GTT CCG CTA A 3' NP_459778.1
sopA 5' ATT CAG ACA CGG CGA TGA TG 3' 5' TGG CGT CCG TCA GGT GAT AAG CA 3' NP_461011.1
sopB 5' TGA GTA ACC CGA CGG ATA CCA GT 3' 5' AGC ATC AGA AGG CGT CTA ACC AC 3' NP_460064.1
sopD 5' TTA CTA TCA AGA TGG ACG CTT CT 3' 5' GTG CAT TTC CCG TCA CTT 3' NP_461866.1
sopE2 5' CGG CGT AAC CTC TTT CAT AAC GA 3' 5' AGG GTA GGG CGG TAT TAA CCA GT 3' NP_460811.1
sptP 5' AGG CGT CTT CCA GCA TTC TAT TG 3' 5' GAT CAC CAG CCG TTA CCG TCT AC 3' NP_461799.1
spvB 5' AAC TTA ATC CCT CCG CAA TAT CA 3' 5' CGT TCC CGC AAA GCT ACA 3' NP_490529.1
ssaB 5' TTT AAA AGG CAT TCC ATT AAT TC 3' 5' TTT ATG GTG ATT GCG TAT TAC AT 3' NP_460358.1
ssaM 5' ATG GAT TGG GAT CTC ATT ACT GA 3' 5' GGA ATA CCC TGG AAC GCT 3' NP_460378.1
sseF 5' CGG CAA GTA ATA TAG TCG ATG GT 3' 5' AAG GGT GTT AGC GCA GTT AAG A 3' NP_460369.1
sseG 5' CCG GAC TTG CGA AAC GAG TG 3' 5' CCC ATC CAT ACC GAA GCG AGT AA 3' NP_460370.1
sseI 5' TCA TAT TGG AAG CGG ATG TC 3' 5' GGC CAT TCA GAT TAC TCA TAC CT 3' NP_460026.1
sseJ 5' CAG GAA CAC GCC GAT AAG TTG A 3' 5' CCG CCA AAG TAT TGA CCA TAG GA 3' NP_460590.1
sseL 5' GAA CGG GAT CAT CAG ATA TAG AC 3' 5' CCC AAT AGG ATA GTT TAC CGA 3' NP_461229.1
sspH2 5' GGT GGG TCA GCG GGT TAC T 3' 5' CCT TTC ATA TTG GAA GCG GAT GT 3' NP_461184.1