Skip to main content

Table 2 PCR primers used in cloning and real-time RT-PCR analysis

From: Proteinase-activated receptor-2: two potential inflammatory mediators of the gastrointestinal tract in Atlantic salmon

Gene name Accession number Primer name PCR primer sequence PCR annealing temperature (C°) PCR product size (bp)
PAR-2 - PAR-2F ATCTACATGGCCAACCTGGC 58 149
PAR-2 - PAR-2R_Deg CAGTACAYGTTCCCGTAGAAGAA   
PAR-2a - PAR-2a_RACE_F1 GTCCGACCTGCTCTTTGTCATCTGGA 68 1316*
PAR-2a - PAR-2a_RACE_R1 TGGACTCCCCTGAAGATTGCCTACCAC   739*
PAR-2b - PAR-2b_RACE_F1 CTGGACACCTCTGAAGATCGCCTACCAC   1655*
PAR-2b - PAR-2b_RACE_R1 GCCCACCAGGACTTTACACAGCCT   687*
PAR-2a - PAR-2a_RT_F1 GCGCTACTGTGCCATCGTCAA 60 104
PAR-2a - PAR-2a_RT_R1 TGGTCATCAGCCAGACCCCCA   
PAR-2b - PAR-2b_RT_F1 ACGCTACTGGGGTGTGGCCCA   104
PAR-2b - PAR-2b_RT_R1 TGGTGGTGAGCCAGATGAAGG   
ELF-1 α AF321836 SS-EF1-alpha F1 GTGCTGTGCTTATCGTTGCT 60 148
ELF-1 α AF321836 SS-EF1-alpha R1 GGCTCTGTGGAGTCCATCTT   
β-actin AF012125 SS beta-aktin F1 CAAAGCCAACAGGGAGAAGATGA 58 133
β-actin AF012126 SS beta-aktin R1 ACCGGAGTCCATGACGATAC   
GAPDH BU693999 GAPDH F1 AAGTGAAGCAGGAGGGTGGAA 60 96
GAPDH BU693999 GAPDH R1 CAGCCTCACCCCATTTGATG   
18S rRNA AJ427629 SS-18SrRNA F1 TACAGTGAAACTGCGAATGG 60 153
18S rRNA AJ427629 SS-18SrRNA R1 GCATGGGTTTTGGGTCTG   
  1. PAR-2: Proteinase-activated receptor-2, ELF-1 α: Elongation factor 1 alpha, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase. * PCR product size after RACE amplification