Skip to main content

Advertisement

Table 1 Sequences for Taqman RT-PCR. Sequences for primers and probes were designed using Primer Express (Applied Biosystems).

From: Nurr1 dependent regulation of pro-inflammatory mediators in immortalised synovial fibroblasts

Gene Size of product Primer Sequence (5'-3')
Nurr1 77 bp Forward TGTGTTCAGGCGCAGTATGG
   Reverse TCCCGAAGAGTGGTAACTGTAGC
   Probe CCTCGCCTCAAGGAGCCAGCC
AREG 70 bp Forward ACTCGGCTCAGGCCATTATG
   Reverse AAAATGGTTCACGCTTCCCA
   Probe TGCTGGATTGGACCTCAATGACACCTACT
KITLG 75 bp Forward TGGTGGCAAATCTTCCAAAAG
   Reverse CAATGACTTGGCAAAACATCCA
   Probe CATGATAACCCTCAAATATGTCCCCGGG