Skip to main content

Table 1 Sequences of the primers used in the RT-PCR reaction and the size of the amplified products of human and viral genes

From: Heat shock protein and heat shock factor 1 expression and localization in vaccinia virus infected human monocyte derived macrophages

Gene of interest Size of the product Primer orientation Primer sequence
β-actin 307 bp Forward
Reverse
5' AGCGGGAAATCGTGCGTG 3'
5' GGGTACATGGTGGTGCCG 3'
hsf1 577 bp Forward
Reverse
5' ATGGCCAGCTTCGTGCG 3'
5' ACAGCATCAGGGGCGTA 3'
hsp70 590 bp Forward
Reverse
5' TTTGACAACAGGCTGGTGAACC 3'
5' GTGAAGGATCTGCGTCTGCTTGG 3'
hsp90 1498 bp Forward
Reverse
5' GCTGTGCCGTTGGTCCTGTGC 3'
5' GGTTCTCCTTCATTCTGGTGC 3'
E3L 360 bp Forward
Reverse
5' TATATTGACGAGAGTTCTGAC 3'
5' ACTCATTAATAATGGTGACAGG 3'
F17R 283 bp Forward
Reverse
5' ATTCTCATTTTGCATCTGCTC 3'
5' AGCTACATTATCGCGATTAGC 3'