Skip to main content

Table 1 Primer sequences and PCR conditions, OC = osteocalcin, COL = collagen, TUB-B = tubulin β

From: Green Tea Extract (GTE) improves differentiation in human osteoblasts during oxidative stress

   Sequence 5´ to 3
  Accession no. Forward primer Reverse primer
OC NM_199173.3 CCAGCGGTGCAGAGTCCAGC GACACCCTAGACCGGGCCGT
COL1A1 NM_000088.3 AGCGGACGCTAACCCCCTCC CAGACGGGACAGCACTCGCC
TUB-B NM_001069.2 GAGGGCGAGGACGAGGCTTA TCTAACAGAGGCAAAACTGAGCACC